nf-core/smrnaseq
A small-RNA sequencing analysis pipeline
1.1.0). The latest
stable release is
2.4.0
.
Define where the pipeline should find input data and save output data.
Input FastQ files.
stringUse this to specify the location of your input FastQ files. For example:
--input 'path/to/data/sample_*.fastq'
Please note the following requirements:
- The path must be enclosed in quotes
- The path must have at least one
*wildcard character
NB: This pipeline does not support paired-end data.
If you have paired-end data, please just pass the Read 1 files to the pipeline.
Protocol for constructing smRNA-seq libraries.
stringPresets for trimming parameters and 3' adapter sequence with a specified protocol.
| Protocol | Library Prep Kit | Trimming Parameter | 3' Adapter Sequence |
| :------------ | :-------------------------------------- | :-------------------------------------- | :--------------------- |
| illumina | Illumina TruSeq Small RNA | clip_r1 = 0 three_prime_clip_r1 = 0 | TGGAATTCTCGGGTGCCAAGG |
| nextflex | BIOO SCIENTIFIC NEXTFLEX Small RNA-Seq | clip_r1 = 4 three_prime_clip_r1 = 4 | TGGAATTCTCGGGTGCCAAGG |
| qiaseq | QIAGEN QIAseq miRNA | clip_r1 = 0 three_prime_clip_r1 = 0 | AACTGTAGGCACCATCAAT |
| cats | Diagenode CATS Small RNA-seq | clip_r1 = 3 three_prime_clip_r1 = 0 | AAAAAAAAAAA + GATCGGAAGAGCACACGTCTG (only polyA is used for trimming) |
| custom | user defined | user defined | user defined |
NB: When running
--protocol customthe user must define the 3' Adapter Sequence.
If trimming parameters aren't provided the pipeline will deafult toclip_R1 = 0andthree_prime_clip_R1 = 0(i.e. no extra clipping).
The output directory where the results will be saved.
string./resultsEmail address for completion summary.
string^([a-zA-Z0-9_\-\.]+)@([a-zA-Z0-9_\-\.]+)\.([a-zA-Z]{2,5})$Set this parameter to your e-mail address to get a summary e-mail with details of the run sent to you when the workflow exits. If set in your user config file (~/.nextflow/config) then you don't need to specify this on the command line for every run.
Options for the reference genome indices used to align reads.
Name of iGenomes reference.
stringIf using a reference genome configured in the pipeline using iGenomes, use this parameter to give the ID for the reference. This is then used to build the full paths for all required reference genome files e.g. --genome GRCh38.
See the nf-core website docs for more details.
Species for miRTrace.
stringThis is automatically set when using --genome. Example values: hsa, mmu...
Path to reference genome FASTA genome file.
stringIf you have no genome reference available, the pipeline can build one using a FASTA file. This requires additional time and resources, so it's better to use a pre-build index if possible.
GFF/GTF file with coordinates positions of precursor and miRNAs.
stringmiRBase .gff3 file, typically downloadedfrom ftp://mirbase.org/pub/mirbase/CURRENT/genomes/
If using iGenomes with --genome this file will be downloaded from miRBase automatically during the pipeline run.
Path to FASTA file with mature miRNAs.
stringftp://mirbase.org/pub/mirbase/CURRENT/mature.fa.gzTypically this will be the mature.fa file from miRBase. Can be given either as a plain text .fa file or a compressed .gz file.
Defaults to the current miRBase release URL, from which the file will be downloaded.
Path to FASTA file with miRNAs precursors.
stringftp://mirbase.org/pub/mirbase/CURRENT/hairpin.fa.gzTypically this will be the mature.fa file from miRBase. Can be given either as a plain text .fa file or a compressed .gz file.
Defaults to the current miRBase release URL, from which the file will be downloaded.
Path to the Bowtie 1 reference genome index.
stringPath to the parsed reference folder containing the files for the miRDeep2.
stringSave generated reference genome files to results.
booleantrueSaving generated references means that you can use them for future pipeline runs, reducing processing times.
Directory / URL base for iGenomes references.
strings3://ngi-igenomes/igenomesDo not load the iGenomes reference config.
booleanDo not load igenomes.config when running the pipeline. You may choose this option if you observe clashes between custom parameters and those supplied in igenomes.config.
List of bowtie index files
arrayDiscard reads that are shorter than this after quality / adapter trimming.
integer17Bp to remove from the 5' end of read 1
integerBp to remove from the 3' end of read 1 AFTER adapter/quality trimming has been performed
integerSequencing adapter sequence to search for and remove.
stringTGGAATTCTCGGGTGCCAAGGprotocol to be used for the mirtrace process
stringtrimgalore max-length parameter
integer40Skip all QC steps
booleanSkip FastQC
booleanSkip miRDeep
booleanSkip MultiQC
booleanLess common options for the pipeline, typically set in a config file.
Display help text.
booleanMethod used to save pipeline results to output directory.
stringThe Nextflow publishDir option specifies which intermediate files should be saved to the output directory. This option tells the pipeline what method should be used to move these files. See Nextflow docs for details.
Boolean whether to validate parameters against the schema at runtime
booleantrueText about sequencing center which will be added in the header of output bam files.
stringEmail address for completion summary, only when pipeline fails.
string^([a-zA-Z0-9_\-\.]+)@([a-zA-Z0-9_\-\.]+)\.([a-zA-Z]{2,5})$This works exactly as with --email, except emails are only sent if the workflow is not successful.
Send plain-text email instead of HTML.
booleanSet to receive plain-text e-mails instead of HTML formatted.
File size limit when attaching MultiQC reports to summary emails.
string25.MBIf file generated by pipeline exceeds the threshold, it will not be attached.
Do not use coloured log outputs.
booleanSet to disable colourful command line output and live life in monochrome.
Custom config file to supply to MultiQC.
stringDirectory to keep pipeline Nextflow logs and reports.
string${params.outdir}/pipeline_infoShow all params when using --help
booleanSet the top limit for requested resources for any single job.
Maximum number of CPUs that can be requested for any single job.
integer16Use to set an upper-limit for the CPU requirement for each process. Should be an integer e.g. --max_cpus 1
Maximum amount of memory that can be requested for any single job.
string128.GB^\d+(\.\d+)?\.?\s*(K|M|G|T)?B$Use to set an upper-limit for the memory requirement for each process. Should be a string in the format integer-unit e.g. --max_memory '8.GB'
Maximum amount of time that can be requested for any single job.
string240.h^(\d+\.?\s*(s|m|h|day)\s*)+$Use to set an upper-limit for the time requirement for each process. Should be a string in the format integer-unit e.g. --max_time '2.h'
Parameters used to describe centralised config profiles. These should not be edited.
Git commit id for Institutional configs.
stringmasterProvide git commit id for custom Institutional configs hosted at nf-core/configs. This was implemented for reproducibility purposes. Default: master.
## Download and use config file with following git commit id
--custom_config_version d52db660777c4bf36546ddb188ec530c3ada1b96
Base directory for Institutional configs.
stringhttps://raw.githubusercontent.com/nf-core/configs/masterIf you're running offline, nextflow will not be able to fetch the institutional config files from the internet. If you don't need them, then this is not a problem. If you do need them, you should download the files from the repo and tell nextflow where to find them with the custom_config_base option. For example:
## Download and unzip the config files
cd /path/to/my/configs
wget https://github.com/nf-core/configs/archive/master.zip
unzip master.zip
## Run the pipeline
cd /path/to/my/data
nextflow run /path/to/pipeline/ --custom_config_base /path/to/my/configs/configs-master/
Note that the nf-core/tools helper package has a
downloadcommand to download all required pipeline files + singularity containers + institutional configs in one go for you, to make this process easier.
Institutional configs hostname.
stringInstitutional config name.
stringInstitutional config description.
stringInstitutional config contact information.
stringInstitutional config URL link.
string